IthaID: 277
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Poly A (-TA); (AATAAA>AAAA) | HGVS Name: | HBB:c.*110_*111delTA |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGCCTTGAGCATCTGGATTCTGCCTAA [-/TA] AAAAACATTTATTTTCATTGCAAT (Strand: -)
Also known as:
Comments: Found in a French β-thalassaemic patient originating from Normandy. Found in an African American presenting with typical β-thal trait.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72128 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | 3'UTR, Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | French, African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Ghanem N, Girodon E, Vidaud M, Martin J, Fanen P, Plassa F, Goossens M, A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms., Human mutation, 1(3), 229-39, 1992
- Kimberland ML, Boehm CD, Kazazian HH, Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T., Human mutation, 5(3), 275-6, 1995
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-10-02 10:20:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.