IthaID: 2764
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs3812163 | HGVS Name: | NC_000006.12:g.7725527A>T |
Context nucleotide sequence:
CCTGAGGGTTTGGGGTCGGATGTGT [A/T] GACTTCTCTGTTCATTTGTGCTTTG (Strand: -)
Also known as:
Comments: SNP associated with osteonecrosis/avascular necrosis in individuals of West African and African Caribbean descent with sickle cell disease (39 cases; 205 controls).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | West African, African Caribbean |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ulug P, Vasavda N, Awogbade M, Cunningham J, Menzel S, Thein SL, Association of sickle avascular necrosis with bone morphogenic protein 6., Ann. Hematol. , 88(8), 803-5, 2009
- Lettre G, The search for genetic modifiers of disease severity in the β-hemoglobinopathies., Cold Spring Harb Perspect Med , 2(10), , 2012
Created on 2016-05-16 09:58:23,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.