IthaID: 2762
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs267201 | HGVS Name: | NC_000006.12:g.7853358A>G |
Context nucleotide sequence:
ACAAATGTTGACATTTGATTCAGTA [A/G] TGAAATGGCATAGTCCTGGAAACAA (Strand: +)
Also known as:
Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls). SNP associated with risk of stroke in the CSSCD (92 cases; 1306 controls) [PMID: 15778708], but the association was not replicated in an independent sample of pediatric sickle cell patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823]. SNP associated with risk of pulmonary hypertension in individuals with sickle cell disease acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=111) [PMID: 18187665].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] Stroke [HP:0001297] [OMIM:601367] Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005
- Sebastiani P, Ramoni MF, Nolan V, Baldwin CT, Steinberg MH, Genetic dissection and prognostic modeling of overt stroke in sickle cell anemia., Nat. Genet. , 37(4), 435-40, 2005
- Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-16 09:49:27 | The IthaGenes Curation Team | Created |
2 | 2018-04-19 18:37:49 | The IthaGenes Curation Team | Reviewed. Clinical Phenotype and Reference added. |
3 | 2018-04-19 18:45:05 | The IthaGenes Curation Team | Reviewed. Mutation comment added. |