IthaID: 2762

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs267201 HGVS Name: NC_000006.12:g.7853358A>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACAAATGTTGACATTTGATTCAGTA [A/G] TGAAATGGCATAGTCCTGGAAACAA (Strand: +)

Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls). SNP associated with risk of stroke in the CSSCD (92 cases; 1306 controls) [PMID: 15778708], but the association was not replicated in an independent sample of pediatric sickle cell patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823]. SNP associated with risk of pulmonary hypertension in individuals with sickle cell disease acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=111) [PMID: 18187665].

External Links

Location

Chromosome: 6
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: BMP6
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005
  2. Sebastiani P, Ramoni MF, Nolan V, Baldwin CT, Steinberg MH, Genetic dissection and prognostic modeling of overt stroke in sickle cell anemia., Nat. Genet. , 37(4), 435-40, 2005
  3. Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008
  4. Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011
Created on 2016-05-16 09:49:27, Last reviewed on 2018-04-19 18:45:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.