IthaID: 2748


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7982726 HGVS Name: NG_011485.1:g.25141T>C

Context nucleotide sequence:
ACATGTCTCTAttccagcaaaacaa [C/T] ctcagggaaggtatctcattggcct (Strand: +)

Also known as:

Comments: SNP associated with HbF levels in the younger subjects (<24 years; n=980) of the Cooperative Study of Sickle Cell Disease (CSSCD).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 13
Locus: NG_011485.1
Locus Location: 25141
Size: 1 bp
Located at: KL
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
Created on 2016-05-15 16:18:48, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.