IthaID: 2746

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs7985485	HGVS Name:	NC_000013.11:g.32786336C>A

Context nucleotide sequence:
AGCGTGTCATTATTTTACTACTGTT [A/C] ATCTCATAAGTTGGAGTCACTTCAG (Strand: +)

Also known as: hCV3118898

Comments: SNP associated with osteonecrosis (442 cases; 455 controls) and leg ulcers (243 cases;516 controls) in the Cooperative Study of Sickle Cell Disease (CSSCD).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Leg ulcers [OMIM:150590] Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	13
Locus:	N/A
Locus Location:	N/A
Size:	1 bp
Located at:	PDS5B
Specific Location:	N/A

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005
Nolan VG, Adewoye A, Baldwin C, Wang L, Ma Q, Wyszynski DF, Farrell JJ, Sebastiani P, Farrer LA, Steinberg MH, Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathway., Br. J. Haematol. , 133(5), 570-8, 2006

Created on 2016-05-13 16:04:31, Last reviewed on 2016-05-16 10:48:01 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-13 16:04:31	The IthaGenes Curation Team	Created
2	2016-05-16 10:03:52	The IthaGenes Curation Team	Reviewed.
3	2016-05-16 10:48:01	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.