IthaID: 2718
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs7130110 | HGVS Name: | NG_000007.3:g.22742C>G |
Context nucleotide sequence:
CCAGTTATGCCACACTTTCCTACAT [C/G] ATGGGCACTGAAGGTTAAAACTTGA (Strand: +)
Also known as:
Comments: SNP associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD) (≥24 years, n=538; <24 years, n=980). Associated with the HbF response to hydroxyurea in pediatric patients with sickle cell disease.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Hb F response to hydroxyurea |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 22742 |
Size: | 1 bp |
Located at: | ε |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, Hispanic |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
- Ware RE, Despotovic JM, Mortier NA, Flanagan JM, He J, Smeltzer MP, Kimble AC, Aygun B, Wu S, Howard T, Sparreboom A, Pharmacokinetics, pharmacodynamics, and pharmacogenetics of hydroxyurea treatment for children with sickle cell anemia., Blood , 118(18), 4985-91, 2011
- Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013
Created on 2016-05-13 09:47:57,
Last reviewed on 2016-05-25 11:27:24 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-13 09:47:57 | The IthaGenes Curation Team | Created |
2 | 2016-05-13 11:27:52 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-05-25 11:25:46 | The IthaGenes Curation Team | Reviewed. |
4 | 2016-05-25 11:27:24 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-03 11:48:06