IthaID: 269


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: 3'UTR -13 bp [CAP +1567 to +1579] HGVS Name: HBB:c.*93_*105delATCTGGATTCTGC
Hb Name: N/A Protein Info: β nts 1565 - 1577 deleted

Context nucleotide sequence:
ATATTATGAAGGGCCTTGAGC [-/ATCTGGATTCTGC] CTAATAAAAAACATTTATTTTCA (Strand: -)

Also known as:

Comments: Found in two members of a family; in a heterozygous state in the mother and in combination with a β+ mutation in a patient with transfusion-dependent thalassaemia. Reported in literature as HBB:c.*91_*103delGCATCTGGATTCT, which does not follow the HGVS Sequence Variant Nomeclature guidelines.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72111
Size: 13 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Başak AN, Ozer A, Kirdar B, Akar N, A novel 13 Bp deletion in the 3'UTR of the beta-globin gene causes beta-thalassemia in a Turkish patient., Hemoglobin, 17(6), 551-5, 1993
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-11 12:39:27 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.