IthaID: 269
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | 3'UTR -13 bp [CAP +1567 to +1579] | HGVS Name: | HBB:c.*93_*105delATCTGGATTCTGC |
Hb Name: | N/A | Protein Info: | β nts 1565 - 1577 deleted |
Context nucleotide sequence:
ATATTATGAAGGGCCTTGAGC [-/ATCTGGATTCTGC] CTAATAAAAAACATTTATTTTCA (Strand: -)
Also known as:
Comments: Found in two members of a family; in a heterozygous state in the mother and in combination with a β+ mutation in a patient with transfusion-dependent thalassaemia. Reported in literature as HBB:c.*91_*103delGCATCTGGATTCT, which does not follow the HGVS Sequence Variant Nomeclature guidelines.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72111 |
Size: | 13 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Turkish |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Frequencies
Publications / Origin
- Başak AN, Ozer A, Kirdar B, Akar N, A novel 13 Bp deletion in the 3'UTR of the beta-globin gene causes beta-thalassemia in a Turkish patient., Hemoglobin, 17(6), 551-5, 1993
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-11 12:39:27 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-06-04 12:21:19 | The IthaGenes Curation Team | Reviewed. Variation size corrected. HbVar link added. |
4 | 2014-10-09 16:21:52 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
5 | 2019-11-11 12:39:27 | The IthaGenes Curation Team | Reviewed. Mutation names and Location corrected. DNA info and Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07