IthaID: 2686

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs1042713	HGVS Name:	NG_016421.1:g.5285A>G, NG_016421.1:g.5285A=

Context nucleotide sequence:
CAGCGCCTTCTTGCTGGCACCCAAT [A/G] GAAGCCATGCGCCGGACCACGACGT (Strand: +)

Also known as:

Comments: SNP (GG genotype) associated with elevated red blood cell adhesion to laminin in individuals with sickle cell disease (SCD) acquired from the Sickle cell Centre of the Duke University. Red cell adhesion is thought to contribute to the vaso-occlusive process in SCD [PMID: 18324973]. SNP associated with chronic pain in SCD and was found to be in a linkage disequilibrium block in the studied cohort [PMID: 28162517].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Pain [HP:0012531] RBC adhesion

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	5
Locus:	NG_016421.1
Locus Location:	5285
Size:	1 bp
Located at:	ADRB2
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	N/A
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Eyler CE, Jackson T, Elliott LE, De Castro LM, Jonassaint J, Ashley-Koch A, Telen MJ, beta(2)-Adrenergic receptor and adenylate cyclase gene polymorphisms affect sickle red cell adhesion., Br. J. Haematol. , 141(1), 105-8, 2008
Jhun E, He Y, Yao Y, Wilkie D, Molokie R, Wang J, (283) Beta2-adrenergic receptor gene polymorphisms and haplotypes associate with chronic pain in sickle cell disease., J Pain , 17(4), S46-S47, 2016

Created on 2016-05-12 09:50:42, Last reviewed on 2017-10-16 17:23:11 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-12 09:50:42	The IthaGenes Curation Team	Created
2	2016-05-25 17:04:13	The IthaGenes Curation Team	Reviewed.
3	2017-02-28 13:41:07	The IthaGenes Curation Team	Reviewed. Mutation comment and Clinical phenotype sections updated. Reference added.
4	2017-10-16 17:05:51	The IthaGenes Curation Team	Reviewed. Clinical phenotype edited.
5	2017-10-16 17:23:11	The IthaGenes Curation Team	Reviewed. Mutation comment updated.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.