IthaID: 2684
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs10518707 | HGVS Name: | NG_011990.1:g.12428A>G |
Context nucleotide sequence:
TACTATCCACTGTTGGTTATCTAAG [A/G] CCCTTCCTATAAACAGCAGCCTGCC (Strand: +)
Also known as:
Comments: SNP associated with bacteraemia in the Cooperative Study of Sickle Cell Disease (CSSCD) (145 cases; 1248 controls). SNP associated with HbF levels in the older subjects (≥ 24 years) of the CSSCD (n=538).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Bacteremia [HP:0031864] |
Location
| Chromosome: | 15 |
|---|---|
| Locus: | NG_011990.1 |
| Locus Location: | 12428 |
| Size: | 1 bp |
| Located at: | SMAD3 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Adewoye AH, Nolan VG, Ma Q, Baldwin C, Wyszynski DF, Farrell JJ, Farrer LA, Steinberg MH, Association of polymorphisms of IGF1R and genes in the transforming growth factor- beta /bone morphogenetic protein pathway with bacteremia in sickle cell anemia., Clin. Infect. Dis. , 43(5), 593-8, 2006
- Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
Created on 2016-05-11 18:02:26,
Last reviewed on 2019-07-03 14:35:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.