IthaID: 2681

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs267188 HGVS Name: NC_000006.12:g.7840548T>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTGTTGGCCAAAGGTCTAGGACAGG [A/T] GAGAAATTTCCACTGGGATGGTCTG (Strand: +)

Comments: SNP associated with bacteremia in the Cooperative Study of Sickle Cell Disease (CSSCD) (145 cases; 1248 controls).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Bacteremia [HP:0031864]

Location

Chromosome: 6
Locus:
Locus Location: N/A
Size: 1 bp
Located at: BMP6
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Adewoye AH, Nolan VG, Ma Q, Baldwin C, Wyszynski DF, Farrell JJ, Farrer LA, Steinberg MH, Association of polymorphisms of IGF1R and genes in the transforming growth factor- beta /bone morphogenetic protein pathway with bacteremia in sickle cell anemia., Clin. Infect. Dis. , 43(5), 593-8, 2006
Created on 2016-05-11 17:31:50, Last reviewed on 2019-07-03 14:40:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.