IthaID: 268

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Variant of Uncertain Significance
Common Name:	3'UTR +47 C>G	HGVS Name:	HBB:c.*47C>G
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
TTTCTATTAAAGGTTCCTTTGTTCC [C/G] CTATTAAAGGTTCCTTTGTTCCTAT (Strand: -)

Also known as: Terminal CD +47 C>G

Comments: Found in a Middle Eastern (Armenian) case in compound heterozygosity with IVS I-130 G>C [IthaID:118], presented with mild β-Thalassaemia intermedia phenotype.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP	LOVD
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β++
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	72065
Size:	1 bp
Located at:	β
Specific Location:	3'UTR

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Other 3'UTR site (mRNA Processing)
Ethnic Origin:	Armenian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Publications / Origin

Ho PJ, Hall GW, Luo LY, Weatherall DJ, Thein SL, Beta-thalassaemia intermedia: is it possible consistently to predict phenotype from genotype?, Br J Haematol, 100(1), 70-8, 1998
Thein SL, Beta-thalassaemia., Baillieres Clin Haematol, 11(1), 91-126, 1998

Created on 2010-06-16 16:13:15, Last reviewed on 2022-05-17 16:15:18 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-10-09 16:19:22	The IthaGenes Curation Team	Reviewed. Common name corrected
4	2021-03-16 22:56:04	The IthaGenes Curation Team	Reviewed. Comment and References added. Chromosome location corrected.
5	2022-05-17 16:15:18	The IthaGenes Curation Team	Reviewed. Common name corrected. Links added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.