IthaID: 2678
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs8007267 | HGVS Name: | NC_000014.9:g.54912273C>T |
Context nucleotide sequence:
AATAGGAGCGTGTGTTTGAACAGTA [C/T] ACGCCAAACTTCAGTCATTCAAGTA (Strand: +)
Also known as:
Comments: SNP associated with severe pain crises in individuals with sickle cell disease (SCD) acquired from the Bethesda Sickle Cell Cohort Study at NIH (155 cases;73 controls). The association was replicated in an independent SCD cohort acquired from the Cooperative Study of Sickle Cell Disease (CSSCD) (313 cases; 200 controls).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Pain [HP:0012531] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African, African American, Caribbean |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Belfer I, Youngblood V, Darbari DS, Wang Z, Diaw L, Freeman L, Desai K, Dizon M, Allen D, Cunnington C, Channon KM, Milton J, Hartley SW, Nolan V, Kato GJ, Steinberg MH, Goldman D, Taylor JG, A GCH1 haplotype confers sex-specific susceptibility to pain crises and altered endothelial function in adults with sickle cell anemia., Am. J. Hematol. , 89(2), 187-93, 2014
Created on 2016-05-11 17:09:36,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-11 17:09:36 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07