IthaID: 2671
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1801106 | HGVS Name: | NG_008330.1:g.78602G>A |
Context nucleotide sequence:
AAGAGTCTACCTGTTTACTATCAAA [A/G] AGGTAAAAAAAAAAAAATAAACTAA (Strand: +)
Also known as: HPA-5
Comments: The HPA-5b allele associated with vaso-occlusive crisis in Bahraini-Arabs with SCA (127 VOC, 130 steady-state) [PMID: 19702628] and in Brazilians of African descent with SCA (34 VOC, 63 steady-state) [PMID: 15355504].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Vaso-occlusive crisis |
Location
| Chromosome: | 5 |
|---|---|
| Locus: | NG_008330.1 |
| Locus Location: | 78602 |
| Size: | 1 bp |
| Located at: | ITGA2 |
| Specific Location: | Exon 13 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Bahraini Arab, African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Castro V, Alberto FL, Costa RN, Lepikson-Neto J, Gualandro SF, Figueiredo MS, Annichino-Bizzacchi JM, Saad ST, Costa FF, Polymorphism of the human platelet antigen-5 system is a risk factor for occlusive vascular complications in patients with sickle cell anemia., Vox Sang. , 87(2), 118-23, 2004
- Al-Subaie AM, Fawaz NA, Mahdi N, Al-Absi IK, Al-Ola K, Ameen G, Almawi WY, Human platelet alloantigens (HPA) 1, HPA2, HPA3, HPA4, and HPA5 polymorphisms in sickle cell anemia patients with vaso-occlusive crisis., Eur. J. Haematol. , 83(6), 579-85, 2009
Created on 2016-05-11 11:32:54,
Last reviewed on 2020-03-26 15:54:16 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.