
IthaID: 267
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | 3'UTR +6 C>G | HGVS Name: | HBB:c.*6C>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGGCCCACAAGTATCACTAAGCTCG [C/G] TTTCTTGCTGTCCAATTTCTATTAA (Strand: -)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ β++ (silent) |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72024 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Jankovic L, Dimovski AJ, Kollia P, Karageorga M, Loukopoulos D, Huisman TH, A C----G mutation at nt position 6 3' to the terminating codon may be the cause of a silent beta-thalassemia., International journal of hematology, 54(4), 289-93, 1991
- Maragoudaki E, Vrettou C, Kanavakis E, Traeger-Synodinos J, Metaxotou-Mavrommati A, Kattamis C, Molecular, haematological and clinical studies of a silent beta-gene C-->G mutation at 6 bp 3' to the termination codon (+1480 C-->G) in twelve Greek families., British journal of haematology, 103(1), 45-51, 1998
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-05-17 16:07:58 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.