IthaID: 2666
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs3025058 | HGVS Name: | NG_012100.1:g.3394_3395insT |
Context nucleotide sequence:
TCCATTCCTTTGATGGGGGGAAAAA [-/A] CCATGTCTTGTCCTGATTGAAATAC (Strand: +)
Also known as: MMP3 -1171insA , -1171 5A/6A MMP-3
Comments: This polymorphism is an insertion/deletion of a single adenosine (5A/6A) at position -1171 of the MMP3 promoter, with an effect on the level of gene transcription. It associated with stroke risk in pediatric sickle cell disease (SCD) patients acquired from the multicenter Stroke Prevention Trial in Sickle Cell Anemia (STOP) (49 cases, 49 controls) [PMID: 17600229]. The association was not replicated in an independent study, which enrolled pediatric SCD patients from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_012100.1 |
| Locus Location: | 3394 |
| Size: | 1 bp |
| Located at: | MMP3 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hoppe C, Klitz W, D'Harlingue K, Cheng S, Grow M, Steiner L, Noble J, Adams R, Styles L, , Confirmation of an association between the TNF(-308) promoter polymorphism and stroke risk in children with sickle cell anemia., Stroke , 38(8), 2241-6, 2007
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011