IthaID: 2665


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1041163 HGVS Name: NG_023034.2:g.3529T>C

Context nucleotide sequence:
AAGCTAGTATTTCCTGAATCAATTT [C/T] TCTGATCCCTAGATATTTGGTAGGT (Strand: +)

Also known as: −1594T>C

Comments: The VCAM (-1594)C variant predisposed to stroke (small vessel subtype) in pediatric sickle cell disease patients acquired from the Cooperative Study of Sickle Cell Disease (CSSCD) (n=230).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 1
Locus: NG_023034.2
Locus Location: 3529
Size: 1 bp
Located at: VCAM1
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Hoppe C, Klitz W, Cheng S, Apple R, Steiner L, Robles L, Girard T, Vichinsky E, Styles L, , Gene interactions and stroke risk in children with sickle cell anemia., Blood , 103(6), 2391-6, 2004
Created on 2016-05-11 10:05:26, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.