IthaID: 2659
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1042714 | HGVS Name: | NG_016421.1:g.5318C>G |
Context nucleotide sequence:
TGCGCCGGACCACGACGTCACGCAG [C/G/T] AAAGGGACGAGGTGTGGGTGGTGGG (Strand: +)
Also known as: Q27E
Comments: SNP associated with protection from stroke (large vessel subtype) in pediatric sickle cell disease (SCD) patients acquired from the Cooperative Study of Sickle Cell Disease (CSSCD) (n=230) [PMID: 14615367]. The association was not replicated in two independent studies, which enrolled pediatric SCD patients from the Stroke Prevention Trial in Sickle Cell Anemia (STOP) (45 cases; 45 controls) [PMID: 17600229] and the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823], respectively.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 5 |
|---|---|
| Locus: | NG_016421.1 |
| Locus Location: | 5318 |
| Size: | 1 bp |
| Located at: | ADRB2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hoppe C, Klitz W, Cheng S, Apple R, Steiner L, Robles L, Girard T, Vichinsky E, Styles L, , Gene interactions and stroke risk in children with sickle cell anemia., Blood , 103(6), 2391-6, 2004
- Hoppe C, Klitz W, D'Harlingue K, Cheng S, Grow M, Steiner L, Noble J, Adams R, Styles L, , Confirmation of an association between the TNF(-308) promoter polymorphism and stroke risk in children with sickle cell anemia., Stroke , 38(8), 2241-6, 2007
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011