IthaID: 2652

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs489347 HGVS Name: NG_011828.1:g.83070C>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACAGCAAAGAGACAGCAGTGACTTA [C/G] GACTGGAGAAGCTTCTACACATTGA (Strand: -)

Comments: SNP associated with risk of stroke in the Cooperative Study of Sickle Cell Disease (CSSCD) (92 cases; 1306 controls). The association was replicated in an independent sample of pediatric SCD patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study). SNP (allele C) associated with an increased risk of acute cerebral ischemia (n=395) and of high-risk transcranial Doppler (n=338) in a pediatric Brazilian cohort with SCD.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 9
Locus: NG_011828.1
Locus Location: 83070
Size: 1 bp
Located at: TEK
Specific Location: Intron

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American | Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011
  2. Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016
Created on 2016-05-10 18:34:03, Last reviewed on 2018-08-13 18:18:28 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.