IthaID: 2649


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs706814 HGVS Name: NG_009549.1:g.14642A>T

Context nucleotide sequence:
GCCACTAATATTTAGCTCTAGATAC [A/T] GTTCTAAATACTTAGATTATCTCAA (Strand: -)

Also known as:

Comments: SNP associated with pulmonary hypertension risk in individuals with sickle cell disease (aged 18 years and older) acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=581).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pulmonary arterial hypertension [HP:0002092] [OMIM:265400]

Location

Chromosome: 12
Locus: NG_009549.1
Locus Location: 14642
Size: 1 bp
Located at: ACVRL1
Specific Location: Intron 8

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008
Created on 2016-05-10 17:43:15, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.