
IthaID: 2646
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs8141971 | HGVS Name: | NG_011884.2:g.77702T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
tgatttcaatgagaggttagtaaaa [A/G] ataaagatgtaattttctcatccca (Strand: +)
Comments: SNP associated with focal segmental glomerulosclerosis in African Americans (56 cases; 1759 controls).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Focal segmental glomerulosclerosis [HP:0000097] |
Location
Chromosome: | 22 |
---|---|
Locus: | NG_011884.2 |
Locus Location: | 77702 |
Size: | 1 bp |
Located at: | MYH9 |
Specific Location: | Intron 12 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Genovese G, Tonna SJ, Knob AU, Appel GB, Katz A, Bernhardy AJ, Needham AW, Lazarus R, Pollak MR, A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9., Kidney Int. , 78(7), 698-704, 2010
Created on 2016-05-10 16:42:47,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.