
IthaID: 264
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp | HGVS Name: | HBB:c.413_418delTGGCTA |
Hb Name: | Hb Stara Zagora | Protein Info: | β 137(H15) - 139(H17) Val-Ala-Asn->0 AND inserted Asp |
Context nucleotide sequence:
GCCTATCAGAAAGTGGTGGCTGGTG [-/TGGCTA] ATGCCCTGGCCCACAAGTATCACTA (Strand: -)
Also known as:
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71987 |
Size: | 6 bp |
Located at: | β |
Specific Location: | Exon 3 |
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | Thalassaemia dominant Dominant |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Bulgarian |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
Publications / Origin
- Petkov GH, Simjanovska L, Tchakarova P, Efremov GD, Hb Stara Zagora: a new hyper-unstable hemoglobin causing severe hemolytic anemia., Hemoglobin, 29(4), 249-56, 2005
- Efremov GD, Dominantly Inherited beta-Thalassemia., Hemoglobin , 31(2), 193-207, 2007
Created on 2010-06-16 16:13:15,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2021-01-15 14:32:59