IthaID: 264


Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp HGVS Name: HBB:c.413_418delTGGCTA
Hb Name: Hb Stara Zagora Protein Info: β 137(H15) - 139(H17) Val-Ala-Asn->0 AND inserted Asp

Context nucleotide sequence:
GCCTATCAGAAAGTGGTGGCTGGTG [-/TGGCTA] ATGCCCTGGCCCACAAGTATCACTA (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71987
Size: 6 bp
Located at: β
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Bulgarian
Inheritance: Dominant
DNA Sequence Determined: Yes
Detection Methods: MLPA

Publications / Origin

  1. Petkov GH, Simjanovska L, Tchakarova P, Efremov GD, Hb Stara Zagora: a new hyper-unstable hemoglobin causing severe hemolytic anemia., Hemoglobin, 29(4), 249-56, 2005
  2. Efremov GD, Dominantly Inherited beta-Thalassemia., Hemoglobin , 31(2), 193-207, 2007
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.