IthaID: 2635


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs11912763 HGVS Name: NG_011884.2:g.104343C>T

Context nucleotide sequence:
GGAAGGAGAGAACAGAAGCCTGCGT [A/G] AAGCCAAGGCAGCCTTGGGCACCCA (Strand: +)

Also known as:

Comments: SNP associated with proteinuria in individuals (18–83 years) with sickle cell disease acquired from the Duke University Medical Center, the University of North Carolina at Chapel Hill, the East Carolina University and the Emory University Sickle Cell Centers (n=521).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Proteinuria [HP:0000093]

Location

Chromosome: 22
Locus: NG_011884.2
Locus Location: 104343
Size: 1 bp
Located at: MYH9
Specific Location: Intron 33

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ashley-Koch AE, Okocha EC, Garrett ME, Soldano K, De Castro LM, Jonassaint JC, Orringer EP, Eckman JR, Telen MJ, MYH9 and APOL1 are both associated with sickle cell disease nephropathy., Br. J. Haematol. , 155(3), 386-94, 2011
Created on 2016-05-10 15:08:56, Last reviewed on 2016-05-16 10:12:07 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.