IthaID: 2623
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs713753 | HGVS Name: | NG_023228.1:g.14418C>T |
Context nucleotide sequence:
CTCCAGGTCAAAGGTGGGGAACCAA [C/T] ACCAAGATCCTGCCCAAAGGCCCAG (Strand: +)
Also known as:
Comments: SNP associated with focal segmental glomerulosclerosis (FSGS) in African Americans (56 cases; 1827 controls).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Focal segmental glomerulosclerosis [HP:0000097] |
Location
| Chromosome: | 22 |
|---|---|
| Locus: | NG_023228.1 |
| Locus Location: | 14418 |
| Size: | 1 bp |
| Located at: | APOL1 |
| Specific Location: | Intron |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African Americans |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Genovese G, Tonna SJ, Knob AU, Appel GB, Katz A, Bernhardy AJ, Needham AW, Lazarus R, Pollak MR, A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9., Kidney Int. , 78(7), 698-704, 2010
Created on 2016-05-10 12:23:24,
Last reviewed on 2016-05-25 09:07:30 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.