
IthaID: 2622
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs157681 | HGVS Name: | NG_011966.2:g.45247C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGAGAAATTGAAATTCTGCCAAAAC [C/G] AGAATATTTTGGGGATTTTCAGTGA (Strand: -)
Comments: SNP associated with HbF levels in the younger subjects (<24 years; n=980) of the Cooperative Study of Sickle Cell Disease (CSSCD).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 6 |
---|---|
Locus: | NG_011966.2 |
Locus Location: | 45247 |
Size: | 1 bp |
Located at: | MAP3K7 |
Specific Location: | Intron 11 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
Created on 2016-05-10 12:08:17,
Last reviewed on 2018-06-21 19:24:39 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.