IthaID: 2620


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs157702 HGVS Name: NG_011966.2:g.74227G>A

Context nucleotide sequence:
CATACATATTTAAGAACTGTGAATG [C/T] AGTAGTAAGGAAATTAGGCTGTGTT (Strand: +)

Also known as:

Comments: SNP associated with leg ulcers in the Cooperative Study of Sickle Cell Disease (CSSCD) (243 cases;516 controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Leg ulcers [OMIM:150590]

Location

Chromosome: 6
Locus: NG_011966.2
Locus Location: 74227
Size: 1 bp
Located at: MAP3K7
Specific Location: Intron 16

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Nolan VG, Adewoye A, Baldwin C, Wang L, Ma Q, Wyszynski DF, Farrell JJ, Sebastiani P, Farrer LA, Steinberg MH, Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathway., Br. J. Haematol. , 133(5), 570-8, 2006
Created on 2016-05-10 11:56:27, Last reviewed on 2019-08-11 02:12:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.