IthaID: 2617


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1434549 HGVS Name: NG_009245.1:g.336782T>C

Context nucleotide sequence:
TGCCCAGAATTCAACAAGATTGTCC [C/T] TTGGCAGTCTTCTTCCTACAAATCA (Strand: +)

Also known as:

Comments: SNP associated with glomerular filtration rate in the Cooperative Study of Sickle Cell Disease (CSSCD) (n=1140).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Abnormal GFR [HP:0012212]

Location

Chromosome: 4
Locus: NG_009245.1
Locus Location: 336782
Size: 1 bp
Located at: BMPR1B
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Nolan VG, Ma Q, Cohen HT, Adewoye A, Rybicki AC, Baldwin C, Mahabir RN, Homan EP, Wyszynski DF, Fabry ME, Nagel RL, Farrer LA, Steinberg MH, Estimated glomerular filtration rate in sickle cell anemia is associated with polymorphisms of bone morphogenetic protein receptor 1B., Am. J. Hematol. , 82(3), 179-84, 2007
Created on 2016-05-10 11:35:35, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.