IthaID: 2610
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs284875 | HGVS Name: | NG_027757.1:g.205852T>C |
Context nucleotide sequence:
CAATAAAGAGACATAAAGCTGTCTG [A/G] CAGGAAGGACATTCGTGACCTGTTA (Strand: +)
Also known as:
Comments: SNP associated with risk of stroke in the Cooperative Study of Sickle Cell Disease (CSSCD) (92 cases; 1306 controls). The association was replicated in an independent sample of pediatric sickle cell disease patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study), in which the T allele associated with increased stroke risk. SNP (allele A) associated with an increased risk of high-risk transcranial Doppler in a pediatric Brazilian cohort with SCA (n=338).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
Chromosome: | 1 |
---|---|
Locus: | NG_027757.1 |
Locus Location: | 205852 |
Size: | 1 bp |
Located at: | TGFBR3 |
Specific Location: | Intron 15 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Sebastiani P, Ramoni MF, Nolan V, Baldwin CT, Steinberg MH, Genetic dissection and prognostic modeling of overt stroke in sickle cell anemia., Nat. Genet. , 37(4), 435-40, 2005
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011
- Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-09 18:33:15 | The IthaGenes Curation Team | Created |
2 | 2016-05-16 11:37:13 | The IthaGenes Curation Team | Reviewed. |
3 | 2018-08-13 18:27:50 | The IthaGenes Curation Team | Reviewed. Mutation comment, Ethnic origin, and Reference added. |