IthaID: 2606


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs284157 HGVS Name: NG_027757.1:g.104640G>A

Context nucleotide sequence:
ATCTGTTCCCAAATGCTTTGTCTGC [A/G] TTCTGTCGAGTTTTGGAGCTGGCCC (Strand: -)

Also known as:

Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls). Associated with acute chest syndrome in individuals with sickle cell disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Acute chest syndrome
Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]

Location

Chromosome: 1
Locus: NG_027757.1
Locus Location: 104640
Size: 1 bp
Located at: TGFBR3
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Lanson Y, Reignoux J, Jobard P, Vandooren M, Rouleau P, Soret JY, [Osteogenic sarcoma of the kidney. Apropos of a case. Review of the literature]., J Urol Nephrol (Paris) , 84(10), 827-34, 1978
Created on 2016-05-09 17:44:10, Last reviewed on 2022-09-13 15:05:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.