IthaID: 2581
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs685417 | HGVS Name: | NG_011485.1:g.27562G>A |
Context nucleotide sequence:
AGAGAAGCAGAAGAACATAATAAAT [A/G] CCCACTGTCCTACTCAATAGAGACT (Strand: +)
Also known as:
Comments: SNP associated with osteonecrosis (442 cases; 455 controls) and leg ulcers (243 cases;516 controls) in the Cooperative Study of Sickle Cell Disease (CSSCD). SNP also associated with HbF levels in the younger subjects (<24 years; n=980) of the CSSCD.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Leg ulcers [OMIM:150590] Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] |
Location
| Chromosome: | 13 |
|---|---|
| Locus: | NG_011485.1 |
| Locus Location: | 27562 |
| Size: | 1 bp |
| Located at: | KL |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005
- Nolan VG, Adewoye A, Baldwin C, Wang L, Ma Q, Wyszynski DF, Farrell JJ, Sebastiani P, Farrer LA, Steinberg MH, Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathway., Br. J. Haematol. , 133(5), 570-8, 2006
- Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
Created on 2016-05-09 10:58:42,
Last reviewed on 2016-05-15 16:25:18 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.