IthaID: 2580


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2149860 HGVS Name: NG_011485.1:g.43419A>G

Context nucleotide sequence:
ATCCAAAAAACATATTAGATAGGCC [A/G] ATTTTGAGGGCATTTATTTGTAGAG (Strand: +)

Also known as:

Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls). SNP also associated with leg ulcers in the CSSCD (243 cases;516 controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Leg ulcers [OMIM:150590]
Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]

Location

Chromosome: 13
Locus: NG_011485.1
Locus Location: 43419
Size: 1 bp
Located at: KL
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005
  2. Nolan VG, Adewoye A, Baldwin C, Wang L, Ma Q, Wyszynski DF, Farrell JJ, Sebastiani P, Farrer LA, Steinberg MH, Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathway., Br. J. Haematol. , 133(5), 570-8, 2006
Created on 2016-05-09 10:46:40, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.