IthaID: 2575
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 58 +C | HGVS Name: | HBD:c.176_177insC |
| Hb Name: | N/A | Protein Info: | δ 58(E2) (+C) modified C-terminal sequence |
Context nucleotide sequence:
CCTCTCCTGATGCTGTTATGGGCAACC [-/C] CTAAGGTGAAGGCTCATGGCAAGA (Strand: -)
Also known as:
Comments: Found in a male in compound heterozygote HPFH-2 and HBD:c.176_177insC, p.Lys60* (Cd58(+C)). No HbA2 detected in this case suggestive of δ-thalassaemic effect. The frameshift (+C) insertion modifies the C-terminal sequence and leads to a premature stop codon that prevents any expression of the mutated HBD allele.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | δ0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 63486 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | L. Harteveld, Cornelis | 2016-03-02 | First report. |
Created on 2016-05-06 14:20:23,
Last reviewed on 2016-08-24 13:34:34 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.