IthaID: 256


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 127/128 -AGG [Glu-Ala>Pro] HGVS Name: HBB:c.383_385delAGG
Hb Name: Hb Gunma Protein Info: β 127(H5) - 128(H6) Gln-Ala->0 AND inserted Pro

Context nucleotide sequence:
GGCAAAGAATTCACCCCACCAGTGC [-/AGG] CTGCCTATCAGAAAGTGGTGGCTGG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71957
Size: 3 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Japanese
Molecular mechanism: Altered α1β1 interface
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Hattori Y, Yamane A, Yamashiro Y, Matsuno Y, Yamamoto K, Yamamoto K, Ohba Y, Miyaji T, Characterization of beta-thalassemia mutations among the Japanese., Hemoglobin, 13(7), 657-70, 1989
  2. Fucharoen S, Fucharoen G, Fukumaki Y, Nakayama Y, Hattori Y, Yamamoto K, Ohba Y, Three-base deletion in exon 3 of the beta-globin gene produced a novel variant (beta gunma) with a thalassemia-like phenotype., Blood, 76(9), 1894-6, 1990
  3. Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-30 09:27:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.