IthaID: 2552


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 59 AAA>AGA [Lys>Arg] HGVS Name: HBG2:c.179A>G
Hb Name: Hb F-Augusta GA Protein Info: Gγ 59(E3) Lys>Arg

Context nucleotide sequence:
TGCCTCTGCCATCATGGGCAACCCCA [A/G] AGTCAAGGCACATGGCAAGAAGGTG (Strand: -)

Also known as:

Comments: No clinical symptoms.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: γ-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 43188
Size: 1 bp
Located at:
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Kutlar F, Ameri A, Patel NH, Zhuang L, Johnson LE, Cheng ML, Kutlar A, Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C]., Hemoglobin , 38(5), 376-80, 2014
Created on 2015-06-16 12:58:24, Last reviewed on 2018-02-20 17:18:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.