IthaID: 2549


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 87 CAC>CAA [His>Glu] HGVS Name: HBA2:c.264C>A
Hb Name: Hb Lansing (A) Protein Info: α2 87(F8) His>Glu

Context nucleotide sequence:
CGCTGTCCGCCCTGAGCGACCTGCA [C/A] GCGCACAAGCTTCGGGTGGACCCGG (Strand: +)

Also known as:

Comments: This variant has identical protein structure to Hb Lansing (ithaID: 2308)

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34156
Size: 1 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Turkish
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Akar N, Torun D, Oztürk A, Hemoglobin Lansing (Alpha) [HBA2 CD87 (HIS>GLU) (C>A)] in a Turkish Individual Resulting from Another Nucleotide Substitution., Turk J Haematol , 31(3), 317-318, 2014
Created on 2015-01-12 12:30:03, Last reviewed on 2015-01-12 12:32:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.