IthaID: 2529


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 50 +GGAGCC HGVS Name: HBA1:c.151_152insGGAGCC
Hb Name: Hb Bakersfield Protein Info: α1 50(CE8) His->0 AND Arg-Ser-His- inserted between 49(CE7) and 51(CE9)

Context nucleotide sequence:
CTACTTCCCGCACTTCGACCTGAGC [-/GGAGCC] ACGGCTCTGCCCAGGTTAAGGGCCA (Strand: +)

Also known as:

Comments: The Hb Bakersfield mutation is an in-frame insertion in the α1-globin gene, encoding a stable high oxygen affinity Hb variant that may lead to erythrocytosis and macrocytosis.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37847
Size: 6 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Jurassian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Brunner-Agten S, von Känel T, Röthlisberger B, Broquet C, Huber AR, Hb Bakersfield (HBA1: c.151_152insGGAGCC): The Insertion of Arg-His Between Codons 49 and 50 of the α1-Globin Chain Leads to Increased Oxygen Affinity., Hemoglobin , 41(1), 1-5, 2017
Created on 2014-10-09 12:05:39, Last reviewed on 2017-06-14 12:48:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.