
IthaID: 2528
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 64 GAC>AAC [Asp>Asn] | HGVS Name: | HBA1:c.193G>A |
Hb Name: | Hb Wädenswil | Protein Info: | α1 64(E13) Asp>Asn |
Context nucleotide sequence:
TAAGGGCCACGGCAAGAAGGTGGCC [A/C/G/T] ACGCGCTGACCAACGCCGTGGCGCA (Strand: +)
Also known as: Hb Burgos
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | Decreased Oxygen Affinity |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37889 |
Size: | 1 bp |
Located at: | α1 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Egyptian, Spanish |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
Publications / Origin
- de la Fuente-Gonzalo F, Martínez Nieto J, Torrejón MJ, Mayor LA, Velasco D, González Fernández FA, Ropero Gradilla P, [Hb Burgos (α1 CD64(E13)(Asp→Asn)): A new hemoglobin variant detected during follow-up of diabetic patients]., Med Clin (Barc) , 144(1), 26-9, 2015
Created on 2014-10-09 11:55:54,
Last reviewed on 2020-10-27 13:10:55 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2014-10-09 11:55:54 | The IthaGenes Curation Team | Created |
2 | 2020-10-27 13:09:42 | The IthaGenes Curation Team | Reviewed. Merged with IthaID 2547. |
3 | 2020-10-27 13:10:55 | The IthaGenes Curation Team | Reviewed. Synonym added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-05-27 12:42:51