IthaID: 2528


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 64 GAC>AAC [Asp>Asn] HGVS Name: HBA1:c.193G>A
Hb Name: Hb Wädenswil Protein Info: α1 64(E13) Asp>Asn

Context nucleotide sequence:
TAAGGGCCACGGCAAGAAGGTGGCC [A/C/G/T] ACGCGCTGACCAACGCCGTGGCGCA (Strand: +)

Also known as: Hb Burgos

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Decreased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37889
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Egyptian, Spanish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Publications / Origin

  1. de la Fuente-Gonzalo F, Martínez Nieto J, Torrejón MJ, Mayor LA, Velasco D, González Fernández FA, Ropero Gradilla P, [Hb Burgos (α1 CD64(E13)(Asp→Asn)): A new hemoglobin variant detected during follow-up of diabetic patients]., Med Clin (Barc) , 144(1), 26-9, 2015
Created on 2014-10-09 11:55:54, Last reviewed on 2020-10-27 13:10:55 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.