IthaID: 2527
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 114 (+CC) | HGVS Name: | HBA2:c.344_345dup |
| Hb Name: | N/A | Protein Info: | α2 115(+CC); modified C-terminal sequence: (114)Pro-Pro-Pro-Ser-Ser-Pro-Leu-Arg-Cys-Thr-Pro-Pro-Trp-Thr-Ser-Ser-Trp-Leu-Leu-(133)COOH |
Context nucleotide sequence:
GCTGGTGACCCTGGCCGCCCACCTC [-/CC] CCGCCGAGTTCACCCCTGCGGTGCA (Strand: +)
Also known as:
Comments: The mutation causes a frameshift that results in a premature stop codon at amino acid 134. Sequencing results revealed a CC insertion within a repeat of four cytosines. This insertion probably gives rise to a dominant alpha-thalassemic mutation considering the probable absence of protein expression and the very low hematologic parameters of the heterozygous child. Patient and his father presented with severe microcytosis and hypochromia and elevated erythrocytes values.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ Dominant |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34378 |
| Size: | 2 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015
Created on 2014-10-09 11:31:45,
Last reviewed on 2023-08-09 11:00:39 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.