IthaID: 2526

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 142 TAA>TTA >172aa	HGVS Name:	HBA2:c.428A>T
Hb Name:	Hb Kinshasa	Protein Info:	α2 142, Stop>Leu; modified C-terminal sequence: (142)Leu-Ala-Gly-Ala-Ser-Val-Ala-Val-Pro-Pro-Ala-Arg-Trp-Ala-Ser-Gln-Arg-Ala-Leu-Leu-Pro-Ser-Leu-His-Arg-Pro-Phe-Leu-Val-Phe-(172)Glu-COOH

Context nucleotide sequence:
ACCGTGCTGACCTCCAAATACCGTT [A/T] AGCTGGAGCCTCGGTAGCCGTTCCT (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	α-chain variant
Allele Phenotype:	N/A
Stability:	Hyperunstable
Oxygen Affinity:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34462
Size:	1 bp
Located at:	α2
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Congolese
Molecular mechanism:	Elongated globin
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015

Created on 2014-10-09 11:15:42, Last reviewed on 2016-09-09 09:39:24 (Show full history)

A/A	Date	Curator(s)	Comments
1	2014-10-09 11:15:42	The IthaGenes Curation Team	Created
2	2014-10-09 11:16:49	The IthaGenes Curation Team	Reviewed. HbVar link added.
3	2014-10-09 11:33:08	The IthaGenes Curation Team	Reviewed. HGVS name corrected.
4	2016-09-09 09:39:24	The IthaGenes Curation Team	Reviewed. Reference added. Confirmed by sequencing.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.