IthaID: 2522


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 69 GGT>G-T HGVS Name: HBB:c.209delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AAGGCTCATGGCAAGAAAGTGCTCG [G/-] TGCCTTTAGTGATGGCCTGGCTCAC (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70933
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: African american
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Kluge ML, Hoyer JD, Swanson KC, Oliveira JL, β-Thalassemia Major Resulting from Compound Heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a Novel β(0)-Thalassemia Frameshift Mutation: HBB: c.209delG; p.Gly70Valfs*20., Hemoglobin , 2014
Created on 2014-07-15 10:37:09, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.