IthaID: 2520
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 147 TGA>TTA | HGVS Name: | HBD:c.443G>T |
| Hb Name: | N/A | Protein Info: | δ 147 Stop>Leu |
Context nucleotide sequence:
AATGCCCTGGCTCACAAGTACCATT [G/T] AGATCCTGGACTGTTTCCTGATAAC (Strand: -)
Also known as:
Comments: The mutation results in an elongation of the transcript with 15 extra amino acids before reaching the new stop codon (TAG).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia, δ-chain variant |
| Allele Phenotype: | δ0 |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 64651 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Oman |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hassan SM, Harteveld CL, Bakker E, Giordano PC, Known and New δ-Globin Gene Mutations and Other Factors Influencing Hb A2 Measurement in the Omani Population., Hemoglobin , 2014
- Alkindi S, AlZadjali S, Daar S, Ambusaidi R, Gravell D, Al Haddabi H, Krishnamoorthy R, Pathare A, First report of the spectrum of δ-globin gene mutations in Omani subjects - identification of novel mutations., Int J Lab Hematol , 2014
Created on 2014-07-15 10:10:21,
Last reviewed on 2014-08-22 09:38:40 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.