IthaID: 252

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 126-131 (-17 bp) HGVS Name: HBB:c.380_396delTGCAGGCTGCCTATCAG
Hb Name: Hb Westdale Protein Info: β 126 - 131 (-TGCAGGCTGCCTATCAG); modified C-terminal sequence: (126)Glu-Ser-Gly-Gly-Trp-Cys-(132)Gly-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTGGCAAAGAATTCACCCCACCAG [-/TGCAGGCTGCCTATCAG] AAAGTGGTGGCTGGTGTGGCTAATG (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β0
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71954
Size: 17 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Trinidad, Pakistan, Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Waye JS, Eng B, Francombe WH, Chui DH, Novel seventeen basepair deletion in exon 3 of the beta-globin gene., Human mutation, 6(3), 252-3, 1995
  2. Ahmed S, Petrou M, Saleem M, Molecular genetics of beta-thalassaemia in Pakistan: a basis for prenatal diagnosis., British journal of haematology, 94(3), 476-82, 1996
  3. Dehury S, Meher S, Patel S, Das K, Jana A, Bhattacharya S, Sahoo S, Sarkar B, Mohanty PK, Compound Heterozygote of Hb S (HBB: c.20A>T)/Hb Westdale (HBB: c.380_396delTGCAGGCTGCCTATCAG): Report of Four Cases from Odisha State, India., Hemoglobin, 43(2), 132-136, 2019
  4. Tripathi P, Agarwal S, Gupta A, Mandal K, Biallelic rare 17 bp deletion mutation (HBB:c.380_396 del TGCAGGCTGCCTATCAG) in a transfusion depended form of thalassemia., Ann. Hematol., 2020
Created on 2010-06-16 16:13:15, Last reviewed on 2022-07-13 10:42:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.