IthaID: 2516

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 338 CCC>ACC [Pro>Thr] HGVS Name: NG_013087.1:g.7242C>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTACCGGAAACACACGGGGCAGCGC [C/A] CCTTCCGCTGCCAGCTCTGCCCACG (Strand: -)

Comments: Associated with borderline HbA2.

External Links

No available links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: N/A

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 7242
Size: 1 bp
Located at: KLF1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Lou JW, Li DZ, Zhang Y, He Y, Sun MN, Ye WL, Liu YH, Delineation of the molecular basis of borderline hemoglobin A2 in Chinese individuals., Blood Cells Mol. Dis. , 2014
Created on 2014-06-06 08:17:14, Last reviewed on 2014-06-12 10:41:59 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.