IthaID: 2512
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 299 (CAT>GAT) | HGVS Name: | NG_013087.1:g.6869C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CACCAAGAGCTCCCACCTGAAGGCG [C/G] ATCTGCGCACGCACACAGGTGAGGG (Strand: -)
Comments: Protein change: H299D. Associated with increase production of HbF and with borderline HbA2 in Chinese population.
External Links
No available links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | Increased expression for Aγ or Gγ |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_013087.1 |
| Locus Location: | 6869 |
| Size: | 1 bp |
| Located at: | KLF1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lou JW, Li DZ, Zhang Y, He Y, Sun MN, Ye WL, Liu YH, Delineation of the molecular basis of borderline hemoglobin A2 in Chinese individuals., Blood Cells Mol. Dis. , 2014
- Liu D, Zhang X, Yu L, Cai R, Ma X, Zheng C, Zhou Y, Liu Q, Wei X, Lin L, Yan T, Huang J, Mohandas N, An X, Xu X, Erythroid Krüppel-like factor mutations are relatively more common in a thalassemia endemic region and ameliorate the clinical and hematological severity of β-thalassemia., Blood , 2014
Created on 2014-06-05 16:11:44,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.