IthaID: 2510
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 27 GAG>GAC [Glu>Asp] | HGVS Name: | HBA1:c.84G>C |
| Hb Name: | Hb Hekinan | Protein Info: | α1 27(B8) Glu>Asp |
Context nucleotide sequence:
CGCACGCTGGCGAGTATGGTGCGGA [C/G] GCCCTGGAGAGGTGAGGCTCCCTCC (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37663 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | African, Chinese, Japanese, Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Harano T, Harano K, Imai N, Ueda S, Seki M, An electrophoretically silent hemoglobin variant, Hb Hekinan [alpha 27(B8)Glu----Asp] found in a Japanese., Hemoglobin , 12(1), 61-5, 1988
- Zhao W, Wilson JB, Webber BB, Kutlar A, Tamagnini GP, Kuam B, Huisman TH, Hb Hekinan observed in three Chinese from Macau; identification of the GAG----GAT mutation in the alpha 1-globin gene., Hemoglobin , 14(6), 627-35, 1990
- Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994
- Ngiwsara L, Srisomsap C, Winichagoon P, Fucharoen S, Svasti J, Two cases of compound heterozygosity for Hb Hekinan [alpha27(B8)Glu-->Asp (alpha1)] and alpha-thalassemia in Thailand., Hemoglobin , 28(2), 145-50, 2004
- Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 12:47:02,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.