IthaID: 2509
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | CD 16 AAG>GAG [Lys>Glu] | HGVS Name: | HBA1:c.49A>G |
| Hb Name: | HbI | Protein Info: | α1 16(A14) Lys>Glu |
Context nucleotide sequence:
GACCAACGTCAAGGCCGCCTGGGGT [A/C] AGGTCGGCGCGCACGCTGGCGAGTA (Strand: +)
Also known as: Hb I-Burlington, Hb I-Philadelphia, Hb I-Skamania, Hb I-Texas
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37628 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Australian, Black, Caucasian, Indian, Japanese, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
HPLC
Disclaimer: The HPLC images are provided as an information resource only.
Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes.
D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission.
Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc.
To access HPLC images and reports for different variants, use the IthaChrom tool.
| ID | Hb Variant | Gene | Instrument | Method | Area (%) | Ret Time (min) | Comments | ||
|---|---|---|---|---|---|---|---|---|---|
| 581 | HbI | α1 | D-10 | Dual Kit Program | 10.4 | 1.36 | heterozygote | [PDF] | |
| 582 | HbI | α1 | VARIANT | β-thal Short Program | 14.8 | 1.39 | heterozygote | [PDF] | |
| 598 | HbI | α1 | VARIANT II | Dual Kit Program | 27.9 | 1.491 | Heterozygote. | [PDF] | |
| 597 | HbI | α1 | VARIANT II | β-thal Short Program | 18.1 | 1.43 | Heterozygote. | [PDF] | |
| 584 | HbI | α1 | VARIANT II | Dual Kit Program | 22.5 | 1.467 | heterozygote | [PDF] | |
| 583 | HbI | α1 | VARIANT II | β-thal Short Program | 14.9 | 1.4 | heterozygote | [PDF] |
In silico pathogenicity prediction
Publications / Origin
- Beale D, Lehmann H, Abnormal haemoglobins and the genetic code., Nature , 207(994), 259-61, 1965
- Esan GJ, Morgan FJ, O'Donnell JV, Ford S, Bank A, Diminished synthesis of an alpha chain mutant, hemoglobin I (alpha-16 lys leads to glu)., J. Clin. Invest. , 49(12), 2218-21, 1970
- Fleming PJ, Arnold BJ, Thompson EO, Hughes WG, Morgan L, Hb I alpha16 Lys leads to Glu and Hb Broussais alpha90 Lys leads to Asn in Australian families., Pathology , 10(4), 317-27, 1978
- Saito S, Fujita S, Ohta Y, Kobayashi Y, Hemoglobin I (alpha 16(A14) Lys replaced by Glu) and hemoglobin J Iran (beta 77(EF1) His replaced by Asp) discovered in Japanese., Hemoglobin , 6(5), 537-41, 1982
- Liebhaber SA, Rappaport EF, Cash FE, Ballas SK, Schwartz E, Surrey S, Hemoglobin I mutation encoded at both alpha-globin loci on the same chromosome: concerted evolution in the human genome., Science , 226(4681), 1449-51, 1984
- Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994
- Lin M, Han ZJ, Wang Q, Zheng L, Wang Y, Yang H, Huang Y, Lin F, Zhan XF, Lin CP, Wu JR, Luo ZY, Liu JB, Yan ZH, Zheng SY, Zheng JK, Lu M, Zhu JJ, Xie LX, Yang LY, Molecular epidemiological survey of hemoglobinopathies in the Wuxi region of Jiangsu Province, eastern China., Hemoglobin, 37(5), 454-66, 2013
Created on 2014-06-05 12:34:28,
Last reviewed on 2021-03-11 13:54:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.