IthaID: 2508
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 120 GCG>GAG [Ala>Glu] | HGVS Name: | HBA1:c.362C>A |
| Hb Name: | Hb J-Meerut | Protein Info: | α1 120(H3) Ala>Glu |
Context nucleotide sequence:
CACCTCCCCGCCGAGTTCACCCCTG [A/C] GGTGCACGCCTCCCTGGACAAGTTC (Strand: +)
Also known as: Hb J-Birmingham
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38207 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Indian, Japanese, Turkish |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Blackwell RQ, Wong HB, Wang CL, Weng MI, Liu CS, Hemoglobin J Meerut: alpha120 Ala leads to Glu., Biochim. Biophys. Acta , 351(1), 7-12, 1974
- Harano T, Harano K, Imai K, Yunoki H, Yagi H, Nagashima K, Kuroume T, Hb J-Meerut [alpha 120(H3)Ala----Glu] found in a Japanese family., Hemoglobin , 13(2), 169-75, 1989
- Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994
- Yalçin A, Avcu F, Beyan C, Gürgey A, Ural AU, A case of HB J-Meerut (or Hb J-Birmingham) [alpha 120(H3)Ala-->Glu]., Hemoglobin , 18(6), 433-5, 1994
- Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 12:23:26,
Last reviewed on 2024-02-13 12:34:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.