IthaID: 2505
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 78 AAC>AAG [Asn>Lys] | HGVS Name: | HBA1:c.237C>G |
| Hb Name: | Hb Stanleyville-II | Protein Info: | α1 78(EF7) Asn>Lys |
Context nucleotide sequence:
TGGCGCACGTGGACGACATGCCCAA [C/G] GCGCTGTCCGCCCTGAGCGACCTGC (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37933 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Van Ros G, Beale D, Lehmann H, Haemoglobin Stanleyville II (alpha asparagine replaced by lysine)., Br Med J , 4(5623), 92-3, 1968
- North ML, Darbre PD, Lehmann H, Juif JG, Haemoglobin Stanleyville II (alpha75 [EF 7] Asn yeilds Lys) found in France., Acta Haematol. , 53(1), 56-9, 1975
- Rhoda MD, Martin J, Blouquit Y, Garel MC, Edelstein SJ, Rosa J, Sickle cell hemoglobin fiber formation strongly inhibited by the Stanleyville II mutation (alpha 78 Asn leads to Lys)., Biochem. Biophys. Res. Commun. , 111(1), 8-13, 1983
- Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 11:40:42,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.