IthaID: 2503
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 75 GAC>TAC [Asp>Tyr] | HGVS Name: | HBA1:c.226G>T |
| Hb Name: | Hb Winnipeg | Protein Info: | α1 75(EF4) Asp>Tyr |
Context nucleotide sequence:
GACCAACGCCGTGGCGCACGTGGAC [A/C/G/T] ACATGCCCAACGCGCTGTCCGCCCT (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37922 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Caucasian, Sardinian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
HPLC
Disclaimer: The HPLC images are provided as an information resource only.
Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes.
D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission.
Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc.
To access HPLC images and reports for different variants, use the IthaChrom tool.
| ID | Hb Variant | Gene | Instrument | Method | Area (%) | Ret Time (min) | Comments | ||
|---|---|---|---|---|---|---|---|---|---|
| 373 | Hb Winnipeg | α1 | D-10 | Dual Kit Program | 16.7 | 4.46 | Heterozygote. | [PDF] | |
| 374 | Hb Winnipeg | α1 | VARIANT | β-thal Short Program | 18 | 4.74 | Heterozygote. | [PDF] | |
| 375 | Hb Winnipeg | α1 | VARIANT II | Dual Kit Program | 16.1 | 4.084 | Heterozygote. | [PDF] |
In silico pathogenicity prediction
Publications / Origin
- Vella F, Wiltshire B, Lehmann H, Galbraith P, Hemoglobin Winnipeg: alpha2 75 Asp leads to Tyr beta2., Clin. Biochem. , 6(2), 66-70, 1973
- Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009
Created on 2014-06-05 11:12:32,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.