
IthaID: 25
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | -29 (A>G) | HGVS Name: | HBB:c.-79A>G |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GAGGGCAGGAGCCAGGGCTGGGCAT [A/G] AAAGTCAGGGCAGAGCCATCTATTG (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70516 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | African-American, Chinese |
Molecular mechanism: | TATAA box (HBB) |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Antonarakis SE, Irkin SH, Cheng TC, Scott AF, Sexton JP, Trusko SP, Charache S, Kazazian HH, beta-Thalassemia in American Blacks: novel mutations in the "TATA" box and an acceptor splice site., Proceedings of the National Academy of Sciences of the United States of America, 81(4), 1154-8, 1984
- Huang S, Wong C, Antonarakis SE, Ro-lien T, Lo WH, Kazazian HH, The same "TATA" box beta-thalassemia mutation in Chinese and US blacks: another example of independent origins of mutation., Human genetics, 74(2), 162-4, 1986
Created on 2010-06-16 16:13:14,
Last reviewed on 2013-10-15 17:28:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.