IthaID: 25

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -29 (A>G) HGVS Name: HBB:c.-79A>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GAGGGCAGGAGCCAGGGCTGGGCAT [A/G] AAAGTCAGGGCAGAGCCATCTATTG (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70516
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African-American, Chinese
Molecular mechanism: TATAA box (HBB)
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Antonarakis SE, Irkin SH, Cheng TC, Scott AF, Sexton JP, Trusko SP, Charache S, Kazazian HH, beta-Thalassemia in American Blacks: novel mutations in the "TATA" box and an acceptor splice site., Proceedings of the National Academy of Sciences of the United States of America, 81(4), 1154-8, 1984
  2. Huang S, Wong C, Antonarakis SE, Ro-lien T, Lo WH, Kazazian HH, The same "TATA" box beta-thalassemia mutation in Chinese and US blacks: another example of independent origins of mutation., Human genetics, 74(2), 162-4, 1986
Created on 2010-06-16 16:13:14, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.